Tuesday, November 25, 2014

Learning

The kids continue their lessons on DNA in anticipation of upcoming learning about genetics.
After building their double helix with ACTG they calculated the possible combinations that were possible on their structures.
Those are some seriously yummy double helix.
 
Today, they were given a piece of DNA to transcribe. They changed it to m-RNA.
Then used that RNA in three letter groups to figure out the coded message.
The 26 letters of the alphabet substituted for the 20 amino acids usually coded for with RNA.
Great job working together boys.
If you open the pictures you can see the m-RNA codons. Care to crack the code?
Here's the DNA:
CCCGTCGTTAAACCAGTTAAACGCCCATTTATGTTCATGAGGTTTTTATTCCGTATGTTCGAGTTTAGGTTCAGCTTTGACTCCAAACGTGACCGCTTCCTGCCAAAACGTTTCCTACTA

Week12-Nov17-21
Book Study-The Sign of the Beaver
Math- E-Multiply Decimals, A-Estimate and Solve Mult.
History- Suez Canal
French- Adjectives
Unit Study-See DNA, Build DNA
Extra-Curricular
Kung-Fu
Piano
Nerf/Outdoor Gym
Co-op Final Class

Update Dec2020

My Guy A My Guy E School Rooms at Home Deck the Halls It's Beginning to Look a Lot Like Christmas