Thursday, November 27, 2014

Fa La La La La

We don't normally break out the 'Deck the Halls' until the 1st of December.
But with E leaving for a week we thought we'd start early instead of late.
 
Looks sweet, yes? Your eyes deceive you.
They were both trying to be the person who 'more' put the star on the tree.
When they were supposed to let go, E held on for a few extra seconds .... so before getting off the chair, A reached back and touched it one more time.
Sigh.

 
And here are the trees. 
The 'present' tree in the living room and the skinny bonus tree in the dining room.
We need to NOT buy anymore more ornaments or next year we'll need three trees.
 
All ready for another merry season.
 

Tuesday, November 25, 2014

Learning

The kids continue their lessons on DNA in anticipation of upcoming learning about genetics.
After building their double helix with ACTG they calculated the possible combinations that were possible on their structures.
Those are some seriously yummy double helix.
 
Today, they were given a piece of DNA to transcribe. They changed it to m-RNA.
Then used that RNA in three letter groups to figure out the coded message.
The 26 letters of the alphabet substituted for the 20 amino acids usually coded for with RNA.
Great job working together boys.
If you open the pictures you can see the m-RNA codons. Care to crack the code?
Here's the DNA:
CCCGTCGTTAAACCAGTTAAACGCCCATTTATGTTCATGAGGTTTTTATTCCGTATGTTCGAGTTTAGGTTCAGCTTTGACTCCAAACGTGACCGCTTCCTGCCAAAACGTTTCCTACTA

Week12-Nov17-21
Book Study-The Sign of the Beaver
Math- E-Multiply Decimals, A-Estimate and Solve Mult.
History- Suez Canal
French- Adjectives
Unit Study-See DNA, Build DNA
Extra-Curricular
Kung-Fu
Piano
Nerf/Outdoor Gym
Co-op Final Class

Thursday, November 20, 2014

Week Stuff

Tuesday
Last class of their co-op for the term.
E did a great job presenting what he learned from his project.
A opted out of the presentation.
We are happy that this teacher will be offering classes again in the new year.
 
Wednesday
Nothing takes the place of our home school work though.
Working on a DNA/Genetics Unit right now.
E is modelling a genome they made while learning about nucleotides and how they pair up.
A is modelling what 'focus' looks like.
 
Thursday
I recently stumbled across a program I hadn't known about before.
The kids meet once each week for a fairly epic NERF battle in the gym of a local community centre.
Usually they go outside for the second hour but due to today's cold weather they stayed in and played cards.
 
Lucky us were able to stop by the NFamily's school to see LittleA perform with his dance class.
He did a great job and even was able to invite his cousins up to dance with him!!!
 

Monday, November 17, 2014

Kitchen Science

You know a great way to end a weekend?
With family having a great meal.
But Monday we're back to school.
On the schedule today was a science activity.
 
Did you know that you can see DNA?
Crush some peas/banana/strawberries to break the cell and nucleus wall ..... add soap to break up the lipids surrounding the DNA .... strain out the large bits and keep the slushy stuff.
Then, add very, very cold rubbing alcohol to separate the 'other stuff' from the DNA.
 
And just like that you'll see the stringy DNA, often covered in small bubbles of air, gather on the surface of the rubbing alcohol. The strands glump together and you can actually pick them up with a toothpick.
 
I'd like to say this enthusiasm was because they were so amazed at the science activity.... but I'd be lying.
They're just happy because they finished dessert.

Sunday, November 16, 2014

Assistant to the Hockey Mom

I shadowed my sis the hockey mom on Saturday.
All smiles and helpful hands from the 4 boys on the way to the rink.
 
Hockey gear here, hockey gear there, hockey gear hockey gear everywhere!!
 
While waiting for the last game to start three of the boys hit the park to work off some energy pent up while waiting for ice time and hockey pictures.
After 6 hours (dry land training-one practice-hockey pictures and one game) the spectators were less interested in the action on the ice and more interested in their video games.
 

Thursday, November 13, 2014

Last Fort?

They just keep getting older. And now when they do certain things I think,
"Is this the last time they'll have fun this way?"
Yesterday, A spent over an hour perfecting this fort and I suggested maybe he sleep in it.
An idea that was completely acceptable to him. And sounded pretty good to me too so I crawled in for the night.
E took a look inside and decided that there wasn't quite enough space for three.
 
But not wanting to miss out on the fun he moved onto the couch for the night.
Indoor Campout!!
 
Sometimes you will never know the value of a moment. Until it becomes a memory. -Dr. Seuss

Tuesday, November 11, 2014

That's A Break

How did it happen that I let so many days go by without blogging?
Probable because we've been so focused on socializing the kids lately. Wink wink.
 
Oh also hockey. We did spend some time at the hockey rinks watching my nephews kick some butt.
And also date night. There was a little bit of time set aside for grown ups having fun.
Week 11 Nov10-14
Book Study-The Sign of the Beaver
Math- E-Decimals, A-Multiplying MultiDigit#
History- WestIndies
French-Body Parts
Unit Study-Start DNA Unit (Cells)
Extra-Curricular
Kung-Fu
Piano

Thursday, November 06, 2014

This Will Get Us To Christmas

Week 10-Nov3-7
Book Study-The Sign of the Beaver
Math- E-Review, A-Multiplying in Parts
History- Rails, Zones, Bulbs
Extra-Curricular
The Magic Flute
Kung-Fu
Piano
Co-Op

Saturday, November 01, 2014

Saturday Run

Ready, Set, good Saturday morning to you.
What better way to start the day than to go for a run in -2C weather.

First up, the adults with the 5km.
I've been sidelined with a neck injury for the last several weeks ...
but with M's encouragement I shaved a tiny, tiny little bit of time off my last 5km time.
 
The two boys raced through the 1.5km no problem.
D and K ran the 5km and then joined the boys for their run as well.
Pretty amazing race partners.
 
Love this picture of the boys with their rosy cheeks.
 
 When I was looking through the pictures I noticed that my eldest looks more and more like his dad every day.
 

Christmas Flurry....of Pictures